Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr5:125963064+125963186 123bp AGCTCCTCCCAGACATTCAG GCAAAACAGCAACTCTTCAGC
Mutant= 108 bp
Wild Type= 123 bp
Wt Sequence: agctcctcccagacattcagggccatcagagtcaccgagtccatggcacgtgacatccttaggcctgtggctttccaccaaggggccaccctttgaggctcggctgaagagttgctgttttgc
Mutant Sequence: agctcctcccagacattcagggccatcagagtcaccgAGttgcttgaggaataccgaatcatacctgctagtcccatgtgtgggccagcaacatggctcagtgggtaa
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 33848 | AGC TCC TCC CAG ACA TTC AG | Common | A | |||
| 33849 | TTA CCC ACT GAG CCA TGT TG | Mutant Reverse | A | |||
| 33850 | GCA AAA CAG CAA CTC TTC AGC | Wild type Reverse | A | |||
| 33851 | Fluorophore-1 | CCT TAG GCC TGT GGC TTT C | Quencher-1 | WT Probe | ||
| 33852 | Fluorophore-2 | TGC TTG AGG AAT ACC GAA TCA | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 33848 | 0.40 uM |
| 33849 | 0.40 uM |
| 33850 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.