Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr4:147810905-147811012 108bp GAACCTTTTGCATGTTCTTGG CGCCAAGTTTGCCTTTTAGG
Mutant= 93 bp
Wild Type = 108 bp
Wt Sequence:gaaccttttgcatgttcttggctcctctcATctctgtgtacccggagctctgggcactgtgtggctgaaacttttttttgggacaaatcctaaaaggcaaacttggcg
Mutant Sequence: gaaccttttgcatgttcttggctcctctcAatatggtagaggtcacctcattaccagtgatgaatttgggaacagtttgaccagggttgatgg
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 33590 | GAA CCT TTT GCA TGT TCT TGG | Common | A | |||
| 33591 | CGC CAA GTT TGC CTT TTA GG | Wild type Reverse | A | |||
| 33592 | CCA TCA ACC CTG GTC AAA CT | Mutant Reverse | A | |||
| 33593 | Fluorophore-1 | CAC TGT GTG GCT GAA ACT TTT T | Quencher-1 | WT Probe | ||
| 33594 | Fluorophore-2 | TCT TGG CTC CTC TCA ATA TGG T | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 33590 | 0.40 uM |
| 33591 | 0.40 uM |
| 33592 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.