For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = T/T
Heterozygote = C/T
Wild type = C/C
Sequence
GCAGTTTTACAGCGCAAAGAGGAGGAGGATCGCCAGATG
AAGCAACTTGTCCAAGCCTTA(C/T)AAGTCTCACTAGAGAAAG
AAAAGATGGAAGTGAACAGCCTGAAGGAACAGg
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 18756 | TTA CAG CGC AAA GAG GAG GA | Forward | A | |||
| 18757 | CCT TCA GGC TGT TCA CTT CC | Reverse | A | |||
| 18760 | Fluorophore-1 | GTC CAA GCC TTA CAA GTC TCA CTA G | Quencher-1 | WT Probe | ||
| 18761 | Fluorophore-2 | TGT CCA AGC CTT ATA AGT CTC ACT AGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 18756 | 0.40 uM |
| 18757 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.