Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mut=110 bp
Wt= 125 bp
WT Sequence: tggctggctctcttcatttttataatctgaaagaagtatttgttgtctctcaagggactcaagaaatgtcatTTTCTTTCCCCACCCATGTCtagaatgaattacgcaatagatacagaatatga
MUT Sequence: acataattgaaagtgcccatatacagatactatacacctcattgagaactcatccacatatttgagtaatagatctagaatgaattacgcaatagatacagaatatga
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 32192 | ACA TAA TTG AAA GTG CCC ATA TAC AG | Mutant Forward | A | |||
| 32193 | Fluorophore-1 | CAC CTC ATT GAG AAC TCA TCC A | Quencher-1 | MUT Probe | ||
| 32194 | TGG CTG GCT CTC TTC ATT TT | Wild type Forward | A | |||
| 32195 | Fluorophore-2 | TCT TTC CCC ACC CAT GTC TA | Quencher-2 | WT Probe | ||
| 32196 | TCA TAT TCT GTA TCT ATT GCG TAA TTC | Common | A |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 32192 | 0.40 uM |
| 32194 | 0.40 uM |
| 32196 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.