For in-depth product & services help, ask our
Technical Information Scientists
Mutant = 289 bp
Heterozygote = 231 bp and 289 bp
Wild type = 231 bp
>chr7:4564358-4564588 231bp AGTGGGCTCTTCTACCCACA GGATCCATCCATCAAAGGTG
This assay is capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr 7.
This assay is NOT able to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
43224 | GGC GTT ACT ATG GGA ACA TAC G | Mutant Forward | B | CMV enhancer | ||
57313 | AGT GGG CTC TTC TAC CCA CA | Wild type Forward | A | mChr7 | ||
57314 | GGA TCC ATC CAT CAA AGG TG | Common | A, B | mChr7 |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa 2G HS buffer | 1.30 X |
MgCl2 | 2.60 mM |
dNTPS-kapa | 0.26 mM |
57313 | 0.50 uM |
57314 | 0.50 uM |
Glycerol | 6.50 % |
Dye | 1.00 X |
Kapa 2G HS taq polym | 0.03 U/ul |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 94.0 | -- | |
2 | 94.0 | -- | |
3 | 65.0 | -- | -0.5 C per cycle decrease |
4 | 68.0 | -- | |
5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
6 | 94.0 | -- | |
7 | 60.0 | -- | |
8 | 72.0 | -- | |
9 | -- | repeat steps 6-8 for 28 cycles | |
10 | 72.0 | -- | |
11 | 10.0 | -- | hold |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa 2G HS buffer | 1.30 X |
MgCl2 | 2.60 mM |
dNTPS-kapa | 0.26 mM |
43224 | 0.50 uM |
57314 | 0.50 uM |
Glycerol | 6.50 % |
Dye | 1.00 X |
Kapa 2G HS taq polym | 0.03 U/ul |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 94.0 | -- | |
2 | 94.0 | -- | |
3 | 65.0 | -- | -0.5 C per cycle decrease |
4 | 68.0 | -- | |
5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
6 | 94.0 | -- | |
7 | 60.0 | -- | |
8 | 72.0 | -- | |
9 | -- | repeat steps 6-8 for 28 cycles | |
10 | 72.0 | -- | |
11 | 10.0 | -- | hold |
Stock Number | Strain Name |
---|---|
025854 | B6;FVB-Ptprca Tg(CAG-luc,-GFP)L2G85Chco Thy1a/J |
010545 | C.FVB-Tg(CAG-luc,-GFP)L2G85Chco/FathJ |
010548 | D1.FVB(Cg)-Tg(CAG-luc,-GFP)L2G85Chco/FathJ |
008450 | FVB-Tg(CAG-luc,-GFP)L2G85Chco/J |
010542 | NOD.FVB-Tg(CAG-luc,-GFP)L2G85Chco/FathJ |
025855 | STOCK Ptprca Lag3tm1Doi Tg(CAG-luc,-GFP)L2G85Chco Thy1a/J |
6 strains use this protocol |