Protocol 18226: End Point Analysis Assay - Tyr c-EP
Version 4.0

Notes

This mutation introduces a DdeI enzyme restriction site.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = C/C

WT = G/G

Het = C/G

 

Sequence

ATGTTCTTGGCTGTTTTGTATTGCCTTCTGTGGAGTTTCCAGATCTCTGATGGCCATTTTCCTCGAGCCTGTGCCTCCTCTAAGAACTTGTTGGCAAAAGAATG
CTGCCCACCATGGATGGGTGATGGGAGTCCCTGCGGCCAGCTTTCAGGCAGAGGTTCCTGCCAGGATATCCTTCTGTCCAGTGCACCATCTGGACCTCAGTTCCCCTTCAAAGGGGTGGA
TGACCGTGAGTCCTGGCCCTCTGTGTTTTATAATAGGACCTGCCAGTGCTCAGGCAACTTCATGGGTTTCAACTGCGGAAACT(g/c)TAAGTTTGGATTT
GGGGGCCCAAATTGTACAGAGAAGCGAGTCTTGATTAGAAGAAACATTTTTGATTTGAGTGTCTCCGAAAAGAATAAGTTCTTTTCTTACCTCACTTTAGCAAAACATACTATCAGCTCAGTCT
ATGTCATCCCCACAGGCACCTATGGCCAAATGAACAATGGGTCAACACCCATGTTTAATGATATCAACATCTACGACCTCTTTGTATGGATGCATTACTATGTGTC

Albino = C

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
17285 AAT AGG ACC TGC CAG TGC TC Forward A
17286 GCC TGT GGG GAT GAC ATA GA Reverse A
17430 Fluorophore-1 CTG CGG AAA CTC TAA GTT TGG AT Quencher-1 MUT Probe A
17432 Fluorophore-2 CTG CGG AAA CTG TAA GTT TGG AT Quencher-2 WT Probe A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
17285 0.40 uM
17286 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
009100 B6.129-Arntltm1Bra/J
000899 C.B6-Tyr+ Hbbs/J
002930 C.C3-Tlr4Lps-d/J
002106 KK/HlJ
026622 NOD.Cg-KitW-41J Tyr + Prkdcscid Il2rgtm1Wjl/ThomJ
014173 STOCK Omptm1.1(COP4*/EYFP)Tboz/J
6 strains use this protocol