Stock No: 000642
Protocol 31185: QPCR Assay - Dock7<m> qPCR
Version 3.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

 

Wild Type Dock7
acataatgatttcaataacagacacgtgtcttttttatttaaagTGGATACCAATGCTGCAG
AATGGACGGTTGAAGACAGGGCAGTTCTGCCTGCCAGTCTCCCTGGAAAAACCACCGCAGGC
TTATTCAGTGCTTTCCCCCGAGgtcagtgccttccagcaag
 
Dock7<m>
ACATAATGATTTCAATAACAGACACGTGTCTTTTTTATTTAAAGTGGATACCAATGCTGCAG
AATGGACGGTTGAAGACCAGTTGCAGAAACGAGGATTATAAAGTAATATGAATGCCCATTGT
AAATTTACTAATGCGTTTGCGATTGTACGAGGGATAGTTAT

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
14825 AGT GGA TAC CAA TGC TGC AG Common A
14826 TGG TTT TTC CAG GGA GAC TG Wild type Reverse A
14828 GGG CAT TCA TAT TAC TTT ATA ATC CTC G Mutant Reverse A
14829 Fluorophore-1 TCT GCA ACT GGT CTT CAA CCG TCC Quencher-1 MUT Probe
14848 Fluorophore-2 ATG GAC GGT TGA AGA CAG GGC A Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
14825 0.40 uM
14826 0.40 uM
14828 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.