For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:28680477+28680568 92bp CCACTCAGTAGCAAAATTACACTTG ATGTGTGGGTCCTGACCTATCT
Mut= 131 bp
Wt= 92 bp
Fam=Mut
Hex=Wt
The Reverse primer (primer 62576) anneals over the nucleotide sequence containing mouse genomic variations rs234553771.
Sequence
Wt Sequence:
attcagtgtttccctagtgttcccaacaccctgaagccaaaagaaacaactaagtcagcagttctcaacatgtgggtcacgaccgtaggagaagcacatatttcttatggtcttaggaactgacataaaccactcagtagcaaaattacacttgtgaaataacaaaataaatttatatctgggttcctaggaccataggagataggtcaggacccacacattgggagctgctgctctaagggatctgaatgctctgtggggttgattcctcttggcatagtggctcagaaacagcacgcctacatttaaaatattttagacttcacttttaaatagccatgattgctaagtcaagtgactctgttgtcatcacacagtgctttggctttg
Mutant Sequence:
ACGACCGTAGGAGAAGCACATATTTCTTATGGTCTTAGGACTGACATAAACCACTCAGTAGCAAAATTACACTTGTGAAATAACAAAATAAATTTATATCTGGGTTCCTAGATAACTTCGTATAATGTATGCTATACGAAGTTATACTAGGACCATAGGAGATAGGTCAGGACCCACACATTGGGAGCTGCTGCTCTAAGGGATCTGAATGCTCTGTGGGG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62575 | CCA CTC AGT AGC AAA ATT ACA CTT G | Forward | A | |||
| 62576 | ATG TGT GGG TCC TGA CCT ATC T | Reverse | A | |||
| 62577 | Fluorophore-1 | TGG GTT CCT AGG ACC ATA G | Quencher-1 | WT Probe | ||
| 63926 | Fluorophore-2 | CTG GGT TCC TAG ATA ACT TCG TAT AAT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62575 | 0.40 uM |
| 62576 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.