For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:48158653+48158752 100bp GCCAAGAAAGAGATATGGGAAAG TCTCAGACTAACTTGCTATAATGGTCA |
Mutant= 90 bp
Wild Type = 100 bp
The Mut Reverse primer (primer 62845) anneals over the nucleotide sequence containing mouse genomic variations rs220240503 and rs237859889; the WT Reverse primer (primer 62844) anneals over the nucleotide sequence containing mouse genomic variation rs260969335; and the WT Probe (63669) anneals over the nucleotide sequence containing mouse genomic variation rs240017168.
Sequence
Wt Sequence (deletions in lower case)
GCCAAGAAAGAGATATGGGAAAGTGAAAAATTGTGTGTCCctgtagaagacaattggtaatcatttctattcatgaccattatagcaagttagtctgagaagaaataggtcttatgttgagagatggtcctagtagtattgctctttttcatttgtagcaactgcgctccaatatccgagaaatggagaagctttgcttgaaagtgcacaaggatgatctggtccttttgaagcgaatgatagatcctgtcaaggaagcagcagcaacagctacggcagagttcctccagctccacttggaatctgttgaagaactcaagaaacaagtcaacgatgaagaattacttcagccttctctgaccagatccacaactgttgatggtaacatatgtcttacttttgatcctacttggcacagttagagagagctcacctactcaggtgtgatgaacagagagaggcccttgtaaatccTTGTCGTTGCTAAGCCAACTCCAAACAGACCAGACATGTGTACCCTGGAA
This mutation is a 434 bp deletion beginning at Chromosome 4 position 48,158,693 bp and ending after 48,159,126 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62843 | GCC AAG AAA GAG ATA TGG GAA AG | Common | A | |||
| 62844 | TCT CAG ACT AAC TTG CTA TAA TGG TCA | Wild type Reverse | A | |||
| 62845 | TTC CAG GGT ACA CAT GTC TGG | Mutant Reverse | A | |||
| 63669 | Fluorophore-1 | CCC TGT AGA AGA CAA TTG GTA ATC A | Quencher-1 | WT Probe | ||
| 63670 | Fluorophore-2 | ATT GTG TGT CCT TGT CGT TGC T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62843 | 0.40 uM |
| 62844 | 0.40 uM |
| 62845 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.