Protocol 39469 - Fst<tm1Zuk>-Probe

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant= 79 bp

Wild Type = 71 bp

chr13:114458716-114458786 71bp ACCGCAAACCTCGGAGAC GATTCAATGGACGTCAGAAGC

Sequence

Wt Sequence: cctcccacagccccacacactgggagaccgcccaccGCAAAcctcggagacccccgtctaGAtttaaagcgcggctgcgcccggcttctGACGTCCATTGAATCGCGCGGGCGGCCGGTGGCGAGCGCGGGGCTGCGCCGGGATCGCTGCGCCCTCCGCCGCTCGCCTCTGCGACGCGCGCCGCTCGCCCGAGCCACCCGCCGCCGCGCTCCTCGCCCCGCGcctgccccaggATGGTCTGCGCCAG

Mutant Sequence: CCCACACACTGGGAGACCGCCCACCGCAAACCTCGGAGACCCCCGTCTAGcccatcgataagcttgatatcgaattctaccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttaa

JAX Protocol

Protocol Primers

Primer	5' Label	Sequence 5' → 3'	3' Label	Primer Type	Reaction
41272		GAT TCA ATG GAC GTC AGA AGC		Wild type Reverse	A
53881		ACC GCA AAC CTC GGA GAC		Common	A
53884	Fluorophore-1	CCC GTC TAG CCC ATC GAT AAG C	Quencher-1	MUT Probe
53885	Fluorophore-2	CCC GTC TAG ATT TAA AGC GCG G	Quencher-2	WT Probe
oIMR6592		GAA AAG CGC CTC CCC TAC		Mutant Reverse	A

Reaction A

Component	Final Concentration
Kapa Probe Fast QPCR	1.00 X
ddH2O
41272	0.40 uM
53881	0.40 uM
oIMR6592	0.40 uM
Wt Probe	0.15 uM
Mutant Probe	0.15 uM
DNA

Cycling

Step	Temp °C	Time	Note
1	95.0	--
2	95.0	--
3	60.0	--
4		--	repeat steps 2-3 for 40 cycles
5	40.0	--	Forever

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.