For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 91 bp
Wild Type = 104 bp
>chr10:4746842+4746945 104bp TGCCCTAAAAACAGCAGAGA TCAACCAAGGAGAACAGAGAGAC
Sequence
Wt Sequence: aatagtgtattgtctaaaaactgctctgtttatgccctaaaaacagcagagaacagaaaggaagacaaggtctttgtacagCGctatttgcacaacacatgaatatctagtaagtctctctgttctccttggttgaaacttggaaaagacacagactcccAGGagaagtggtaatgccagggaagctgtggctaagaatttctgcttccccct
Mutant Sequence: TAGTGTATTGTCTAAAAACTGCTCTGTTTATGCCCTAAAAACAGCAGAGAACAGAAAGGAAGACAAGGTCTTTGTACAGCcgcgccgattggccagtactagtgaacctcttcgagggacctaATAACTTCGTATAGCATACATTATACGAAGTTatattaagggttattgaatatgatcggaattatcagatctctagatccgcggtcgacatatgagcgctaagcttgacgtcaccggttctagaacctagGCTATTTGCACAACACATGAATATCTAGTAAGTCTCT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37084 | TGC CCT AAA AAC AGC AGA GA | Common | A | |||
| 47074 | GGT CCC TCG AAG AGG TTC A | Mutant Reverse | A | |||
| 47075 | TCA ACC AAG GAG AAC AGA GAG AC | Wild type Reverse | A | |||
| 47076 | Fluorophore-1 | CTT TGT ACA GCC GCG CCG A | Quencher-1 | MUT Probe | ||
| 47081 | Fluorophore-2 | CTT TGT ACA GCG CTA TTT GCA CAA C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37084 | 0.40 uM |
| 47074 | 0.40 uM |
| 47075 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.