For in-depth product & services help, ask our
Technical Information Scientists
Mutant = T/T
Heterozygote = T/C
Wild type = C/C
>chr5:108855481+108855603 123bp GCGCTTTCTATTCTCTGTCAGC GCCCATCCAATTTACATACG
GCGCTTTCTATTCTCTGTCAGCAAAGCCTATCGAAGAATCACCTACCACAACTGG(c/t)GCCACGGCTTCAATGTAGCCCAGACCATGTTTACCCTACTCATGgtacgtatgtaaattggatgggc
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45546 | GCG CTT TCT ATT CTC TGT CAG C | Forward | A | |||
| 45547 | GCC CAT CCA ATT TAC ATA CG | Reverse | A | |||
| 45548 | Fluorophore-1 | CAA CTG GCG CCA CGG | Quencher-1 | WT Probe | ||
| 45549 | Fluorophore-2 | CAA CTG GTG CCA CGG C | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45546 | 0.40 uM |
| 45547 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.