For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 119 bp
Wild Type = 137 bp
>chr16:84774690+84774826 137bp CAGGGGGACCCTCAGCTA GGAAAGGACTGTTACCCCAGA
Sequence
Wt Sequence:TGCTGGGAGACCCAGCCGCCTGTCGCGCTCCTGCAGGGGGACCCTCAGCTAGGCAGCCAGCTGGCGCCCGCGTAGatgGCGAGGAGCCCCCAAGGCCTCCTGATGCTGCTGCTGCTACACTACTTGATCGTCGCCCTGGACTgtaagtctctggggtaacagtcctttccaccctccggtctggctataccagcctccgggaccctcgcctgcaggcatgg
Mutant Sequence: AAGTGCTGGGAGACCCAGCCGCCTGTCGCGCTCCTGCAGGGGGACCCTCAGCTAGGCAGCCAGCTGGCGCCCGCGTAGctagggataacagggtaatatagaattcttaattaagctagCCACCATGGTGCCCAAGAAGAAGAGGAAAGTCTCCAACCTGCTGACTGTGCACCAAAACCTGCCTGCCCTCCCTGT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40288 | CAG GGG GAC CCT CAG CTA | Common | A | |||
| 40289 | TGG AGA CTT TCC TCT TCT TCT TG | Mutant Reverse | A | Icre | ||
| 40290 | GGA AAG GAC TGT TAC CCC AGA | Wild type Reverse | A | |||
| 40291 | Fluorophore-1 | CCG CGT AGC TAG GGA TAA CAG G | Quencher-1 | MUT Probe | ||
| 40292 | Fluorophore-2 | CCT CCT GAT GCT GCT GCT G | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40288 | 0.40 uM |
| 40289 | 0.40 uM |
| 40290 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.