For in-depth product & services help, ask our
Technical Information Scientists
Mutant =A
Wild type = G
GAGAAGAAATCAGCATATTCCTTACA(g/a)AAATAGTAAGCTTACTCGTTTGCTGAAGG
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 27514 | CTT TCA GAG AAG AAA TCA GCA T | Forward | A | |||
| 27515 | GTT TGA CAG TTT CCT CCA AGA G | Reverse | A | |||
| 27516 | Fluorophore-1 | CAT ATT CCT TAC AGA AAT AGT AAG CTT | Quencher-1 | WT Probe | ||
| 27517 | Fluorophore-2 | CAT ATT CCT TAC AAA AAT AGT AAG CTT | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 27514 | 0.40 uM |
| 27515 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.