For in-depth product & services help, ask our
Technical Information Scientists
A deletion of a single G residue at position 3983 is predicted to result in a frameshift mutation and an alteration of the last 48 amino acids in the encoded protein. (J:4348, J:17202, J:41994)
CCCATTTTTTTCTATTATACAGAAAAA[g]ACAAATGAATGGGGCAAGACAATCAT
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 11049 | Fluorophore | TTC CTA GAC CCC GAT GCT TAG ATA | Forward | |||
| 11050 | Fluorophore | CAA CCT CCA CAC GGA ATT CTT G | Reverse | |||
| 11051 | TTG CCC CAT TCA TTT | SEQ |
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.00 |
| MgCl2 | 2.00 |
| dNTPS-kapa | 0.20 |
| 11049 | 0.50 |
| 11050 | 0.50 |
| Glycerol | 5.00 |
| Kapa 2G HS taq polym | 0.01 |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.