Protocol 39605: Standard PCR Assay - Gt(ROSA)26Sor<(HIF1A)Xxx>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr6:113075919-113076111 193bp CTGGCTTCTGAGGACCG AATCTGTGGGAAGTCTTGTCC

Mutant = 304 bp
Heterozygote = 304 bp and 193 bp
Wild type = 193 bp

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
21306 CTG GCT TCT GAG GAC CG Wild type Forward A
21309 AAT CTG TGG GAA GTC TTG TCC Wild type Reverse A
54199 CCG CTG GAG ACA CAA TCA TA Mutant Forward A HIF1A
54200 CCA TCG GAA GGA CTA GGT GT Mutant Reverse A HIF1A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
21306 0.50 uM
21309 0.50 uM
54199 0.50 uM
54200 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.