For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = A/A
Heterozygote = -/A
Wild type = -/-
>chr2:181113022-181113101 80bp TGGAAGCTCTTGGGATCG ATGGTAAACAGCAGGCTCCA |
Mutation is an A insertion
The WT and Mut probes (probes 54075 and 54076) anneals over the nucleotide sequence containing mouse genomic variation rs27642402.
Sequence
WT sequence showing [insertion]:
GTATGGACCGGAGGGGTGGCACCTGGAAGCTCTTGGGATCGGTAGTCTACGCTCACA[a]GCAAGGTGAGCAGCACTGACCCAGCCTGGAGCCTGCTGTTTACCATGACTTCAAGGCTCCAGGCTGCTCTA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 54075 | Fluorophore-1 | ACG CTC ACA GCA AGG TGA | Quencher-1 | WT Probe | ||
| 54076 | Fluorophore-2 | ACG CTC ACA AGC AAG GTG A | Quencher-2 | MUT Probe | ||
| 54414 | TGG AAG CTC TTG GGA TCG | A | ||||
| 54415 | ATG GTA AAC AGC AGG CTC CA | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 54414 | 0.40 uM |
| 54415 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.