For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:10085988+10086086 99bp TGTGACATTGTTAGCAGCGTATC CCAACGTGCTTCCCTAAAGC
Mut = 104 bp
Wt = 99 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GACATGTAGCCTGTCCCCTTCAGACACTGCACATGGCAGTACATAGGCACACATGTGCACAAAACTCCCAAGAGAAGAATTTATCATTAACCCATttgcagggcttaatcgactattgtgtgtaggggggtcggtgatactgtagattagaatttaactccctctttaacatcttttgtagaatggctttaagtgtcactgtatgtctgaatctcatcaaagacaactgttgctggcttcagaaaaccctcagcagtttatggattatttttcagagtaagtaattcaaagacatccttaccttgtaaggttactaagtgggcatgtaatggaagtgttcaatattgtatgcattgtagagcgttgtcccttgtgtgttgagttggctgtaggctcatcattgtgcttggtctttatcttcttttgaaattaaccacagtgtgacattgttagcagcgtatcttagaactttttttcacttcagctctgcctagcctcaaagctctccccaccTAGGGGCTTTAGGGAAGCACGTTGGGATGCGCGCCCTGCGTTT
This mutation is a 418 bp deletion beginning at Chromosome 2 position 10,085,644 bp and ending after 10,086,061 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51144 | CCA ACG TGC TTC CCT AAA GC | Common | A | |||
| 51145 | TGT GAC ATT GTT AGC AGC GTA TC | Wild type Forward | A | |||
| 51146 | CCT TCA GAC ACT GCA CAT GG | Mutant Forward | A | |||
| 51147 | Fluorophore-1 | CTT CAG CTC TGC CTA GCC TCA | Quencher-1 | WT Probe | ||
| 51148 | Fluorophore-2 | CAT AGG CAC ACA TGT GCA CAA A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51144 | 0.40 uM |
| 51145 | 0.40 uM |
| 51146 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.