For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:80795805-80795900 96bp CCTGAACCCTGGTTGGACAC GGGTTACCTACAACTCCCACT
Mut= 96 bp
Wt= 96 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTTAGGGTCTAACCTAATGACCTTCTATTAGCCACTTCCATTCCCAATAACCCAACTTCCCAGTGAGTCCCCTATTTGTGGGTTCAGGGGTCAGGATTCTGGAGGACAAAGCCAGCATGAGACAGGCAGAAGATGACTTGGTGTTAGAATAAGAGGTGTAGTTTGAAATCCTGgtgagaggaagctgggacttgtggccaacaggatgtagaccaactggacactgaccagaggtggctcttatcctttatccctttccaggcttcgtcgaagacctcagcaggaaatatcactttgaatgctgtagccaagagcagtgtcaggactggatggaagctctgcagcgggccaggtggggctttagggactgatgggagctgggtggaaacatgggggaatgtgaacagtgagcccaatcctttcctccagctacgaatacatgcgacagagcctcatcttctacaggaatgagatcaggaagatgactggcaaggtatgtggggcggtcagggatgggacagctttccctggccttgctcacagccaccgtgccctccacaggaccccctggagcagtttggcatctccgaggaggccaggttccagctgaatagcctgcctaaggatgggcggactacttgtattggctcccagttaaatgtgttggactgaccctctctgggcccctggctaccctgggaagtttttttttttttaatataggttttaatacatctgttcaaaaggtccagaggaggtgggcagggtctgtggtcctcgttctccatgccatctccctgccagcaccccttgagtgtccacatccagggaccgagcctggcacagctcccctatccattgccagatgaatgtataatgctagatgaagctgtgaaccccccccccccctcctgctgatagagcagggcatgggtgctggcctcagtgctcagcctgctctttaataaaggtacctcttttctgagccatgtcggaatgagtggagaagaggagggtgggacacaggctgtgggcacttgggaggcagggggaagaggagggtgggacacaggcagttccagagcatctgggacagagaacaaaacaggcaagctgggctggtggcacacacagtataggtgtaggcaggacttggggggacaagcctctggctcgcagtgtgcctgaaccctggttggacaccctcactgtggagatgtggatccatccttggGTTTTGGGGAGTGGTACTCATATAAGTGGGAGTTGTAGGTAACCCTGATGGGGAAAGGTGTGTTCTGCCCAAGTTGTAAGGGACACCTAAATCCTGGCTTTCTAAACAGGCTGTGTGCACTTGGGAGGCAGCGGGAAGAGGAGGGTAGGACACAGGCAGTTC
This mutation is a 1061 bp deletion beginning at Chromosome 10 position 80,795,850 bp and ending after 80,796,910 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44015 | CCT GAA CCC TGG TTG GAC AC | Wild type Forward | A | |||
| 44016 | GGG TTA CCT ACA ACT CCC ACT | Common | A | |||
| 44017 | CAG GCA GAA GAT GAC TTG GTG | Mutant Forward | A | |||
| 44018 | Fluorophore-1 | CTG TGG AGA TGT GGA TCC ATC | Quencher-1 | WT Probe | ||
| 44020 | Fluorophore-2 | TTT GAA ATC CTG GTT TTG GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44015 | 0.40 uM |
| 44016 | 0.40 uM |
| 44017 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.