For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:113639527+113639616 90bp AGGCTCTCCTTTCCAGTTTAATG AAGTTATGGGGCTCAGCTTC
Mut= 86 bp
Wt= 90 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GTTAGAGCCATGGGTACACCTACCCACCCACCAGAAGTGAGTCAGTGGGTCAGGGTAACTGTCTGGAGGTCCTTCACATTGTCTGGGAGTGAGGAGGTGGACTGGATGACCTGGCTATGTCTGAATCCATGTTTGTCTCACCATCCCAGCACccgaccccgtgctgtgtctaagttaccagatacctccacagccaacatatccccacaagtgtcccaataaccccagcttgtcctcgccctaatttaggtgctggcagagtaagagcgcaggctcggtcaggccaggcgctgtatgtgttggagagggtttgggaaaggcgtcctttctgaccccttggctcattcctggtctgtgtccaccctctccactcttccttcccccagaggatcacaagctggtgttcctgcagcagggtccactcctgctcgtggctgtgtcccggactccacagtctgcagcacagctacgaggtgaactgcttgctgtacacgcccaaattgtgagcacactaacgcgtgcaagcgtggcccgcatcttcgcacataagcagaactatgacctccgtcgcctgttggccggctcagagcgcacactggaccggctcttggacagtgtggagcaagacccgggcgccctgctcctgggcgctgtgcgctgtgtgcctctggcccgtccactgcgggatgccctgggcacactactgcggcgctgtacagccccaggcctggccttgtcagtgctggctgttggcggtcgactgataaccgtggcccaggagaggaatgtgctggcggagtgccggctggaccctgctgatctacagttgctgcttgactgggtgggtgcaccagccttcgcggcaggtgaagcatgggcacctgtgtgcctgcctcgctttaacccagatggtttcttctatgcctatgtggcccgcctggattccatgcccgtctgcctgctgctgcttggtaccaaccgtgaagccttccatgccatggccgcctgccggcgcttagttgaagatgggatgcacaaccttggtgccctgcgtactcttggggaggctgccaacttctctaatggcccagcagccagtgccccagcctacagtgtgcaggctgtgggagcccctggcctccggcattttctctataagccactggatatccctgaacaacaccgccagctgccacagtttaccaggtgggccctgaccccaagttgattgaagatatgtctgaccaagacagtcagcatcttcttcacaggagttaggagagatagtgaggccatgctctagaaatggggagcagacagttctctgatggcagaggcttgagcaccaacctacaggagtccccctgttgtgggagaaaggctctcctttccagtttaatggaggcagcttgtcttacaaccacgagatacCCTCAAGTCTAATGGGAGAAGCTGAGCCCCATAACTTAATCACAGTCCCTAGCCTGAGAGGGGAGGCAGGCTCTGACTCACCATGCCACTGCCTCCCTCTGTTGCAGTCCCGAGCTAGAGGCCCCATACA
This mutation is a 1279 bp deletion beginning at Chromosome 8 position 113,638,301 bp and ending after 113,639,579 bp bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43733 | AGG CTC TCC TTT CCA GTT TAA TG | Wild type Forward | A | |||
| 43734 | AAG TTA TGG GGC TCA GCT TC | Common | A | |||
| 43735 | GGA TGA CCT GGC TAT GTC TGA | Mutant Forward | A | |||
| 43736 | Fluorophore-1 | AGG CAG CTT GTC TTA CAA CCA C | Quencher-1 | WT Probe | ||
| 43737 | Fluorophore-2 | CAC CAT CCC AGC ACC CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43733 | 0.40 uM |
| 43734 | 0.40 uM |
| 43735 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.