For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:34283320+34283417 98bp TGCAATACTACCTGTGTCGTGA ACCTGACTGGAAGCCAAAAG
Mut= 99 bp
Wt= 98 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGAAGCCAAACAAATACGGAAGTCACGAGCTGAAGAACCAATCAGGTGCGCTGCAGGTTCTCGCGAGACTTGCGGGCTGTGGCTCTGGCGTCACTGCGCTGGAGAGAGCGAGGGGCGGAGCTGGGGTTGCGGGGGACCGTGAGGGTTGTTGTTTGTAGGCGGAGGTCTGCGCGACTAGACCCGACATGAGCAGCCCGGAgcgggacgaggggacccctgtccccgacagccgcggccactgcgatgctgacactgtctcggggaccccagaccggcgaccgctgctcggcgaggagaaggcggtgacaggtgagggccgcgcagggatcgtggggagccccgcgccccgagatgtcgagggccttgtcccccagattcgggtggccgcagctaggcagggagagtcacctccttccgttcggggccccgcggcagcggtgttcgtgacaccgaaatatgtggagaaggcccaagaaactcggggagcggagtcccaggcccgtgacgtgaagacggaaccgggcaccgtcgcggctgcagcggaaaagtcagaagtggccacgccagggagcgaggaggtgatggaggtggagcagaagcccgcgggcgaagaaatggagatgctggaggcgagtggaggagtgagggaggcgccggaggaggcagggccctggcacctgggcatagatcttcgcaggaacccgctggaggccatccagctggaactggacactgtgaatgctcaggccgacagggccttccaacatctggagcagaagtttgggcgaatgcgacgacactacctggaacggaggaactacatcattcagaatatcccaggcttctggatgactgccttccggaaccaccctcagttgtccgccatgattaggggtcgggatgcagagatgttaaggtacgtaaccagtctggaggtgaaggaactgagacaccctaagactggctgcaaattcaagttcttttttcgaagaaacccctacttcagaaacaagctgattgtcaaggaatatgaagtgagatcatctggtcgagtggtgtctctttccactccaatcatttggcggagagggcatgagccccagtccttcattcgcagaaaccaagatctcatttgcagcttcttcacctggttctcggaccacagccttccagaatctgacagaatcgctgagattatcaaagaggatctgtggccaaacccactgcaatactacctgtgtcgtgaaggaatccgtagaccccgacgtcgcccaaTAAGGGAGCCAGTGGAGATTCCCAGGCCTTTTGGCTTCCAGTCAGGTTAATCTTTGCATTTGAAAATGCGGCCGGAACTGGTCCCTTCTCACCTGTGCTTGAGCAAATGCAACGGGTATGCAGTGTTTTGATTTCTTTCCTCCTGACTTTTCTGCATCTTCTATCTGGATAGT
This mutation is a 1076 bp deletion beginning at Chromosome 10 position 34,282,295 bp and ending after 34,283,370 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42902 | TGC AAT ACT ACC TGT GTC GTG A | Wild type Forward | A | |||
| 42903 | ACC TGA CTG GAA GCC AAA AG | Common | A | |||
| 42904 | GTT GTT TGT AGG CGG AGG TC | Mutant Forward | A | |||
| 42905 | Fluorophore-1 | CCG TAG ACC CCG ACG TC | Quencher-1 | WT Probe | ||
| 42906 | Fluorophore-2 | CAT GAG CAG CCC GGA TAA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42902 | 0.40 uM |
| 42903 | 0.40 uM |
| 42904 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.