For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:123059082-123059204 123bp CACGGAAATTTTGGCAGGT ACTCGGGTGCAGGAAGTAGA
Mut= 125 bp
Wt= 123 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GAGGCTTTACAGTGTGCAGTGGGGCGGGGAGGGGGGGGGCGGGGGGGTAGATGTGTACAAAGAGGAGAAGAATTGAGTTCTTCTCCTTGGGTTTTTGCTTGTTCTGTTTTCTGAATACACAGTCTGTACAGTGTTCAGGCATTCCaccgaggtaggccttagagcacaggaaggcggcaggcaaagtgcagtttgcatgtgagtaaccctgatgacggggttctcttaggtgttgtgtgttatgcgttgtgtgttgtgtgtgccactactgggcctctgttgtttgcaaaacaaacatagtagtggcactttgcatttttaattttgtgtttatttctcacacagaatttctgtttatagtaagttttattttctaattatttttgttcctacaggctgctgaatcgggaataataaaagttaaaacaatagctgcaagaaacacggaaattttggcaggtaattttttttgcattgaattcaattagtagtgaagattttactaatagttaaatagactcttaaaaccaccaGTTTTTTGAGCATCTACTTCCTGCACCCGAGTATGGTATTCATACACATGACATAGAACATGTGAGTGCCCCTTAATTGTGAACTGATTTTATTTCCCAGAGGTGAAAGCTGTAAAATTCCTTGAAATGAGAGACCTTAAAGCTACCAGTTCCTTTGAATCAAGGATTTTCTTATTCACCTTTGCTTTC
This mutation is a 388 bp deletion beginning at Chromosome 10 position 123,059,114 bp and ending after 123,059,501 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41010 | CAC GGA AAT TTT GGC AGG T | Wild type Forward | A | |||
| 41011 | ACT CGG GTG CAG GAA GTA GA | Common | A | |||
| 41012 | GTG TAC AAA GAG GAG AAG AAT TGA G | Mutant Forward | A | |||
| 41013 | Fluorophore-1 | TGC ATT GAA TTC AAT TAG TAG TGA AGA | Quencher-1 | WT Probe | ||
| 41014 | Fluorophore-2 | CAG GCA TTC CGT TTT TTG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41010 | 0.40 uM |
| 41011 | 0.40 uM |
| 41012 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.