For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 109 bp
Wild Type = 117 bp
>chr6:86367604+86367720 117bp AGGCCAGCCAACACTACAGA ACAGCACCATGGGGAAAAG
Sequence
Wt Sequence: atggccaggtgaggtatggggcctagccttttaatcaaaacagtcaggaagcagaagaaggcagatttctatgagttcaaggccagccaacactacagagtctagAATGaatgagagaaggaaagaaagaaacaaattaggctaaagcctctagaaactggagacctatgttacctccttttccccatggtgctgtgcacatgctaactaccagatagttatggaactactcaaatttgaatgaaacataacagtaatatggaaaactaatggagaggaacccaggggaaatgagtggataactttaaattgtggctcggagtggtggtgcatgcctttaatccagcactagggaagcagaggcaggtggatc
Mutant Sequence:CAGGGCCAGCTCTTCAGCTTGGCCTGGATGAGGGGCAAGGCCAAATCTCCTGCTTATAGCCAAAAGTCAGGACTGACTCACATGTTCAGGACTGGCTCTCAGGGCCAGCTTGCCCTTCATGGCCAGGTGAGGTATGGGGCCTAGCCTTTTAATCAAAACAGTCAGGAAGCAGAAGAAGGCAGATTTCTATGAGTTCAAGGCCAGCCAACACTACAGAGTCTAGAActagtggatcccccgggctgcaggaattctaccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgcta
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40145 | CTA AAG CGC ATG CTC CAG A | Mutant Reverse | A | |||
| 40147 | Fluorophore-1 | ACC GGG TAG GGG AGG CGC | Quencher-1 | MUT Probe | ||
| 40181 | AGG CCA GCC AAC ACT ACA GA | Common | A | |||
| 40182 | ACA GCA CCA TGG GGA AAA G | Wild type Reverse | A | |||
| 40183 | Fluorophore-2 | AGG CTA AAG CCT CTA GAA ACT GGA GAC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40145 | 0.40 uM |
| 40181 | 0.40 uM |
| 40182 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.