For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:155961315-155961401 87bp TCTCTGTTGTGGGGGATGTT ACAATGCTAGGTCAGGCTTCT
Mut= 87 bp
Wt= 87 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
CTTTATAGCAAGACCCTACCTTATTTTACCTTATTTATTCTCTGTCTCTGTCTCTGTCTCTGTCTCTGTCTCTGTCTCTGTCTCTGTCTCTGTCTCTCTGTTGTGGGGGATGTTCAGGCCATCGgtgtgaactgagtatccttcttttataaatggcttgagaagcctgacctagcattgtaagtgcattggataagggctgaagtggttctcaagcctttgatcatgtttgggagcacatgaaactctatagtttctgaagttaacttcagatctctgactctattactatcactttttctcagtagatgtaaccacatcatgggatgcactttctcagaccaaggctgctgtaagtagttttagtttctattttaaacatttacttggtttaaaattgatactatgttatgatgtgattaattagaatatttaattggaaaacaaaggcatagattacacagtgaacaaatgtgagtagtgaagaagtaaactagacactgcagtagggtctcgGGTCTGCTACTGTCATGACATGTCAAGTATTGGAGTGACCTGTGTGGCTCCTCACCTTTAATTAGCTGGTTCACTTTGTGAGTTGATAggtaGGGTGGATATGGGGAGGTTGGATGGTACCTGTGTAGAAGGCTCATTATCAGGG
This mutation is a 392 bp deletion beginning at Chromosome 1 position 155,960,980 bp and ending after 155,961,371 bp (GRCm38/mm10). In addition there is a small indel 1 bp (T) insertion and 4 bp (GGTA) deletion 88 bp after the 392 bp deletion that will not alter the results of the deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39560 | TCT CTG TTG TGG GGG ATG TT | Common | A | |||
| 39561 | ACA ATG CTA GGT CAG GCT TCT | Wild type Reverse | A | |||
| 39562 | AGG TGA GGA GCC ACA CAG GT | Mutant Reverse | A | |||
| 39563 | Fluorophore-1 | CTG AGT ATC CTT CTT TTA TAA ATG GCT T | Quencher-1 | WT Probe | ||
| 39564 | Fluorophore-2 | CCA TCG GGT CTG CTA CTG TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39560 | 0.40 uM |
| 39561 | 0.40 uM |
| 39562 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.