For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 75 bp
Wild Type = 114 bp
>chr8:109422442+109422555 114bp GGTTCGGGCAATGAACAG CCCTTGTGCTCAGAGAAAATC
Sequence
Wt Sequence (deleted regions are in lower case)
TTTTTCCCAGGTCATGAGTCTCGGGGTACCGAAGCCCTGTGTTGGGCAGGAGGACAGCGGCTCTTTAGTGCTGGACTGAACGGAGAAATCCTTGAGTATGACCTACAGGCACTAAACATCAAGTACACTTTGGATGCCTTTGGAGGACCCATCTGGAGTATGACCGCCAGCCCCAGTGGCTCTCAACTTTTGGTCAGTAAGCTAGTATTGATAATACAAAATACAGTAGTCTTGATGGTCAGTCCCttccccgtctcacaagctgttttggtttgttttgaTTTTAGGCAAGTGATAGCTTTAGAGAAGAAACGCTTGTgcatgggggtattagttctgtataaaggctcatttagtctgttttctactcgtctctaatcaggttggttgtgaagatggctccgtgaaactatttgaagtcaccccagaaaaaatccagtttgcaagaaattttgatcggcaaaaaagtaaggcttgttttgggttcgggcaatgaacagcttcaacaagaggttgtctgtttgtgtcaccaaagggacaggatattttcctgtgGCTATAGGATATGCTGTGTAGATTTTCTCTGAGCACAAGGGGAGTTCTAGAAGGCATCCCATTAGGTATCCCATTAGGTAGCATAGTTGTGAAATTCAAAGTAGAAAGCTAGTGTTCCTGTGAAAATGAGTGTATTGTTTATCACCTGCATTTTAGTCCAGGTTTATGTTGTGATAAACT
236 bp deletion beginning at Chromosome 8 positive strand position 106,898,379 bp, and ending at 106,898,614 bp (GRCm38/mm10)
In addition there is an additional 35 bp deletion (ttccccgtctcacaagctgttttggtttgttttga) 38 bp before the 236 bp deletion
)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35294 | CCC TTG TGC TCA GAG AAA ATC | Common | A | |||
| 35295 | GGT TCG GGC AAT GAA CAG | Wild type Forward | A | |||
| 35296 | Fluorophore-1 | ACG CTT GTG CTA TAG GAT ATG CT | Quencher-1 | MUT Probe | ||
| 35297 | Fluorophore-2 | CAA GAG GTT GTC TGT TTG TGT CA | Quencher-2 | WT Probe | ||
| 37099 | GGC AAG TGA TAG CTT TAG AGA AGA | Mutant Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35294 | 0.40 uM |
| 35295 | 0.40 uM |
| 37099 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.