For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 032664
Protocol 31996: Probe Assay - Edil3<Tg(Sox2-cre)1Amc>-Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 102 bp
Wild Type = 100 bp
>chr13:89451280+89451379 100bp TCCCACTATATTGGCTGTAGATTC TCCAGTAAGCCAATGAAACAC
Expected Results note (public):
This assay may be capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr #.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is NOT able to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
(Also add this if it’s a probe assay) This protocol can be used for conventional PCR. Omit probes and run as a separated assay.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38141 | TCC CAC TAT ATT GGC TGT AGA TTC | Wild type Forward | A | |||
| 38142 | TCC AGT AAG CCA ATG AAA CAC | Common | A | |||
| 38143 | Fluorophore-1 | TTG AAA GAA TGC ACT CAT ACT TAG ACT AAT | Quencher-1 | WT Probe | ||
| 38144 | TTC CTT CGG CCT GCT CTT AG | Mutant Forward | A | Sox2 | ||
| 38145 | Fluorophore-2 | CCG AGG CTT ATC ACT CAT ACT TAG ACT A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38141 | 0.40 uM |
| 38142 | 0.40 uM |
| 38144 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.