Stock No: 032321
Protocol 36412: Standard PCR Assay - Rsad2<tm1Kchc> Alternate1
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = ~300 bp
Heterozygote = ~300 bp and 345 bp
Wild type = 345 bp

>chr12:26453729-26454073 345bp TGTGAGCATAGTGAGCAATGG AGCCCACTGATTTTCTTCAGC

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
48704 TGT GAG CAT AGT GAG CAA TGG Wild type Forward A Wt F
48705 AGC CCA CTG ATT TTC TTC AGC Common A Common
oIMR2088 AGA CTG CCT TGG GAA AAG CG Mutant Forward A Neo

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
48704 0.50 uM
48705 0.50 uM
oIMR2088 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.