Stock No: 022506
Protocol 21940: End Point Analysis Assay - Dmd<mdx>End Point
Version 4.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = T/T
Heterozygote = C/T
Wild type = C/C

X-linked mutation

Sequence

TGTTTAGATCTCTAAATTACATAAACTTTTATTTACCTTCTTCTTGATATGAATGAAACT
CATCAAATATGCGTGTTAGTGTAAATGAACTTCTATTTAATTTTGAGGCTCTGCAAAGT
TCTTTGAAAGAGCAA(c/t)AAAATGGCTTCAACTATCTGAGTGACACTGTGAAGGAGA
TGGCCAAGAAAGCACCTTCAGAAATATGCCAGAAATATCTGTCAGAATTTGAAGAGA
TTGAGGGGCACTGGAAGAAACTTTCCTCCCAGTTGGTGGAAAGCTGCCAAAAGCTA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
16077 ATT TTG AGG CTC TGC AAA GTT C Forward A
16078 GCC CCT CAA TCT CTT CAA ATT C Reverse A
16079 Fluorophore-1 TGA AAG AGC AAC AAA ATG GCT TC Quencher-1 WT Probe
16080 Fluorophore-2 TGA AAG AGC AAT AAA ATG GCT TC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
16077 0.40 uM
16078 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
017929 B10.Cg-Cmahtm1Avrk Dmdmdx/PtmJ
027818 B10.Cg-Dmdmdx Tg(ACTA1-DMD*)326Dua/Mmjax
027820 B10.Cg-Dmdmdx Tg(Myh6-DMD*)#Dua/Mmjax
027819 B10.Cg-Dmdmdx Tg(Myh6-DMD*)47Dua/Mmjax
018018 B10ScSn.Cg-Prkdcscid Dmdmdx/J
019014 B10ScSn.Cg-Utrntm1Ked Dmdmdx/J
027821 B6.B10-Dmdmdx/Mmjax
027822 C.B10-Dmdmdx/Mmjax
001801 C57BL/10ScSn-Dmdmdx/J
013141 D2.B10-Dmdmdx/J
022506 D2.Cg-Utrntm1Ked Dmdmdx/J
027823 FVB.Cg-Dmdmdx Tg(Myh6-DMD*)271Dua/Mmjax
018915 STOCK Terctm1Rdp Dmdmdx/J
016622 STOCK Utrntm1Jrs Dmdmdx/J
014563 STOCK Utrntm1Ked Dmdmdx/J
15 strains use this protocol