For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr9:37729973-37730094 122bp AAGACCGCACTGGACAAAAC GAGTTGGGTGAGCTTGCAG
Mutant= 171 bp
Wild Type = 122 bp
Wt Sequence: AAGACCGCACTGGACAAAACACTGAGGAGAAAAGTCTTTTGATGTaaatgctgatctttcttcatgtaaaagtaagtggttatgcacacctgtatgataacctctGCAAGCTCACCCAactc
Mutant Sequence: ATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCGACTCTAGAATAACTTCGTATAATGTATGCTATACGAAGTTATTTAATTAAaaatgctgatctttcttcatgtaaaagtaagtggttatgcacacctgtatgataacctctgcaagctcacccaactc
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
26816 | GAT CAC TCT CGG CAT GGA C | Transgene Forward | A | |||
36925 | AAG ACC GCA CTG GAC AAA AC | Wild type Forward | A | |||
36926 | GAG TTG GGT GAG CTT GCA G | Common | A | |||
36927 | Fluorophore-1 | CTG TAC AAG TAA AGC GGC CG | Quencher-1 | MUT Probe | ||
36928 | Fluorophore-2 | CTG AGG AGA AAA GTC TTT TGA TGT AAA | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
26816 | 0.40 uM |
36925 | 0.40 uM |
36926 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |