Stock No: 003548
Protocol 19328: End Point Analysis Assay - Ins2<Akita>
Version 5.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results


HET = C/T
MUT = T/T
WT = C/C

 

>chr7:142678732-142678788 57bp GCAGAAGCGTGGCATTGTAG AGCTGGTAGAGGGAGCAGAT

Sequence

 

GCTCTTCTCTATCCAGCTAGAAGCATCAGGGGTGGGGGTCATGATCCTCCCGGACAACT
CAGGGTGGGGGTTATGGGCTACCTGACGGTATTGGTTATCTTGGGGAAAGGAACTGTCT
ATGTTCCAGGTTTGGTCTAACAGGTACCTGTGGGAGGTGCCCAGGGAGCCAGGAGAAA
ACTGGGGATGCAGAGGGAACCAAAGAAGTCTTGGGTAGATCTTTTAGGGGCTATTGTGG
CTAGGCAGATAGATAGATTAAGCTGTGGCTACCCTACCAGCCCCACTCATGTCTCCTGGT
CCCACATATGCACATGCACATACACACACAACTTGTGCTCATTCAAAGGTTTTATTCATT
GCAGAGGGGTAGGCTGGGTAGTGGTGGGTCTAGTTGCAGTAGTTCTCCAGCTGGTAGA
GGGAGCAGATGCTGGTG(C/T)AGCACTGATCTACAATGCCACGCTTCTGCTGGGCCACC
TCCAGTGCCAAGGTCTGAAGGTCACCTGCTCCCGGGCCTCCACCCAGCTCCAGTTGTG
CCACTGCCAGGGAGGTTGTGTCAGAGCAGGCCAGGGCATCAGCAGCACAGAAGCAAA
GACACATAGGAAAATCCAGTCAGGAGTAGCTGAGCAACCTCCTACTACCCCAGGTTTTC
TCGCCCCTTAACCCCTGCAGGTGGCAGGGGTTGCATGCCTGTGGGACAAGTCACTGGTC
ATGGATGGACACATGGGCCTCTAAAGCCTACTCATCTTCAGTCAGTGCAGTGCTCTATGA
GGGCCCTAAATAGGTACCTATCCTGGGATCTAGTCACATGTCCCAAGTTACTACCACCAA
GGACCCCTTAAGGCAGGATTCTTACTCATTCCTGGCAGCTGCCATGTTTACATATGTCTAG
CTTCCCCCAGAAACGTGTCCCCACTCCCTGGTTATCCCGAGACCCTCCACACCTAGGACA
CAATTTACAATGTCCCAAGTGTGAAGAAAACCAGGGTAGTTAGCACTGGGGACAG

 

Single Point Mutation: In the mutant allele a transition from G to A at nucleotide 1907 disrupted an Fnu4HI site in exon 3. This mutation changed the seventh amino acid in the A chain of mature insulin, Cys96 (TGC), to Tyr (TAC). The authors predict that the transition would disrupt a disulfide bond between the A and the B chains and would likely induce a major conformational change in insulin 2 molecules. RT-PCR studies suggest that both normal and mutant Ins2 alleles are transcribed similarly in pancreatic islets of heterozygous mice, although immunofluorescence and immunoblot analyses of heterozygous islets detected reduced levels of insulin and proinsulin.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
13606 Fluorophore-1 GCA GAA GCG TGG CAT TGT AG Quencher-1 Forward A
13607 Fluorophore-2 AGC TGG TAG AGG GAG CAG AT Quencher-2 Reverse A
13608 Fluorophore-3 TCA GTG CTG CAC CAG C Quencher-3 WT Probe
13609 Fluorophore-4 ATC AGT GCT ACA CCA GC Quencher-4 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
13606 0.40 uM
13607 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
007688 129S6.B6-Ins2Akita/CofJ
006860 B6.Cg-Ins2Akita Bdkrb2tm1Jfh/SmiJ
006580 B6.Cg-Ins2Akita Ldlrtm1Her/J
004369 B6.Cg-Rag1tm1Mom Ins2Akita/J
003548 C57BL/6-Ins2Akita/J
007562 D2.B6-Ins2Akita/MatbJ
006867 FVB.B6-Ins2Akita/MlnJ
008659 NOD.Cg-Rag1tm1Mom Ins2Akita Prf1tm1Sdz/SzJ
014568 NOD.Cg-Rag1tm1Mom Ins2Akita Il2rgtm1Wjl/SzJ
9 strains use this protocol