Protocol 41383: Sanger sequencing Assay - Eda<Ta-6J>-SEQ
Version 1.0

Notes

Mut = -

WT= T

X-linked

>chrX:99976036+99976272 237bp ACCTCTGGCACCCTAAGCAG GAGTGGCAGAGTCCCCTGAG
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

SEQ (deletion in lower case):

CCATCACCCGCCACCTGGGGCAGCCGTCCTTTCAACAGCAGCCTTTGGAACCGGGAGAAGATCCACTCCCCCCtGACTCCCAGGACCGGCACCAGGTGAGTCACCTAGGAGGGGCGGCGGCCTTGGAGGCCCCCTCCCCTGCTCGGTTGGGCGGGGGCCTGGGCCTCAGG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
58217 ACC TCT GGC ACC CTA AGC AG Forward A
58218 GAG TGG CAG AGT CCC CTG AG Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
58217 0.50 uM
58218 0.50 uM
Glycerol 6.50 %
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
002016 B6(Cg)-Aw-J EdaTa-6J Chr YB6-Sxr/EiJ
001809 B6.Cg-Aw-J EdaTa-6J +/+ ArTfm/J
000552 B6.Cg-Aw-J EdaTa-6J Sxr
001730 B6.Cg-Aw-J EdaTa-6J Sxrb Hya-/J
000338 C57BL/6J Aw-J-EdaTa-6J/J
5 strains use this protocol