For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 038753
Protocol 46555: Standard PCR Assay - Stxbp1<tm1.1(STXBP1)Bpro>
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:32820027-32820299 273bp CCATGTGTACCTGGCAAGTG CCCTGGAAATAAAGCCCATT
Mutant = ~244 bp
Heterozygote = ~244 bp and 273 bp
Wild type = 273 bp
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68308 | CCA TGT GTA CCT GGC AAG TG | Wild type Forward | A | |||
| 68309 | CCC TGG AAA TAA AGC CCA TT | Wild type Reverse | A | |||
| 68310 | CTG GGC AAC AGA ACG AGA CT | Mutant Forward | A | Human STXBP1 | ||
| 68311 | CCT TGT GTT TGC TAT AAT CCC CTA | Mutant Reverse | A | Human STXBP1 |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 68308 | 0.50 uM |
| 68309 | 0.50 uM |
| 68310 | 0.50 uM |
| 68311 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.