For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 037296
Protocol 43124: Sanger sequencing Assay - Bard1<tm7.1Rjbr> SEQ
Version 2.0
Notes
>chr1:71047626-71047915 290bp TGTTAGGTTGATGGGCACTG AAAAACTTCCTCACCTGTACTGTCA
Mut = GAGGA
WT= CTGGT
The forward primer (primer 61377) anneals over the nucleotide sequence containing mouse genomic variation rs32910344.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
tgttaggttgatgggcactgactcactagaaattactggggattataactggaataaggtaattaataaaataggagtcttgttagtgagtgtgtgccttctctctgttacgtgtttttaccataatgcctattcattaacagGTGAACACCGGGCAGCGAAAGAATGGGCCG(CTGGT/GAGGA)ATTTATAGGCAGTGGGCTTTCTTCACAGCAGCAGAAAATGCTCAGCAAACTTGAGACAGTTCTTAAGGCTAAAAAGTGTATGGAATTTGACAGTACAGgtgaggaagttttt
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 61377 | TGT TAG GTT GAT GGG CAC TG | Forward | A | |||
| 61378 | AAA AAC TTC CTC ACC TGT ACT GTC A | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 61377 | 0.50 uM |
| 61378 | 0.50 uM |
| Glycerol | 6.50 % |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.