Protocol 41746: Probe Assay - Zfp532<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  92 bp

Wild Type = 120 bp

chr18:65625246+65625365 120bp GTCTCAAGTGTTTGGAGTGTAATG CCGAAACACCGAAATGTAAATG

The common primer (*59077) anneals over the nucleotide sequence containing mouse genomic variation rs244015298.

Sequence

Wt Sequence (deletions in lower case):

GAGAAAGGCGTGGTGATGCAGTGCTCCCACCTGATCCTAAAGCCGGTCCCGGCAGACCAGATGATAGTTCCTCCATCCAGCAATACTGCTGCTTCCACTCTGCAGAGCTCTGTGGGAGCTGCCACACACACTGTCCCAAAAGTCCAGCCTGGCATAGCCGGGGCAGTTATCTCAGCTCCGGCAAGCACACCCATGAGCCCAGCCATGCCCCTAGacgaagacccctccaagctctgtagacacagtctcaagtgtttggagtgtaatgaagtcttccaggatgagccgtccctggccacacatttccagcacgctgcagacACCAGTGGACAAGTAGAGTATCATTTACATTTCGGTGTTTCGGGGACGAGGCTGGAGCCGCGAGTGCTTTGACAAATGTCTTGAATTACGGTGGAGAGGGGTGTGTGTGTGTGTGTTTGTGTGTGTGTGTGTGTTCAGGCAAGCACAGGAAAGGGAAAAGATGGTTTTCATAGTATAGGTGCAGTGCTGAAATACAAGGGTAATTCTTCAGCCAGATAGAAAAGTGTGTGCTCTGGTTGGATTATGTTAGGTAATTGAGTAGGCATTGGAAGTCTGATTCTTAGCAGTAAATTCAGTGTCCTCCCATCATATGGAGCGT

 

This is a 107 bp deletion beginning at Chromosome 18 position 65,758,287 bp and ending after 65,758,393 bp (GRCm39/mm39).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
59073 GTC TCA AGT GTT TGG AGT GTA ATG Wild type Forward A
59074 Fluorophore-1 ACA TTT CCA GCA CGC TGC AG Quencher-1 WT Probe
59077 CCG AAA CAC CGA AAT GTA AAT G Common A
59078 Fluorophore-2 AGC CAT GCC CCT AGA CCA GTG Quencher-2 MUT Probe
59079 GTT ATC TCA GCT CCG GCA AG Mutant Forward A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
59073 0.40 uM
59077 0.40 uM
59079 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.