For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 031031
Protocol 30711: Probe Assay - Rab10<em1(IMPC)J> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:3257223-3257324 102bp CTGTTTTTCCTTTCAGCTCAGT CAGCATCACAGGAACCAAAC
Mutant= 141 bp
Wild Type = 102 bp
Sequence
Wt Sequence: ctgtttttcctttcagctcagtatgagtaggtcattaatttcttgccGCtatgaagtgtggagcttataataatagttttctgtttggttcctgtgatgctg
Mutant Sequence: ctgtttttcctttcagctcagtatgagtaggtcattaatttcttgccGCtaaacagtttatcttcaaaatttgttcaataattctatgtattcaagataataaaaattaccagtggttttcctgatgcttttctccaaatg
452 bp deletion beginning at Chromosome 12 positive strand position 3,256,825 bp, ATTGTTGAGGGAGAGAGGGC, and ending after ATAAGCTCCACACTTCATAG at 3,257,276 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35260 | Fluorophore-1 | CTT GCC GCT AAA CAG TTT ATC TTC | Quencher-1 | MUT Probe | ||
| 35261 | CTG TTT TTC CTT TCA GCT CAG T | Common | A | |||
| 35262 | CAG CAT CAC AGG AAC CAA AC | Wild type Reverse | A | |||
| 35263 | CAT TTG GAG AAA AGC ATC AGG | Mutant Reverse | A | |||
| 35264 | Fluorophore-2 | CCG CTA TGA AGT GTG GAG C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35261 | 0.40 uM |
| 35262 | 0.40 uM |
| 35263 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.