For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 119 bp
Wild Type = 128 bp
>chr15:36933756-36933883 128bp CTGGCATTCCACTGTGTTATCT TCACAATGCATGCTCAACAG
Wt Sequence:ctggcattccactgtgttatctgttTttaccaatgatatttgaactgtctggttttagaacaggttctgtaaacatccttttatacattgatgtacatacatttgatactgttgagcatgcattgtga
Mutant Sequence:ctggcattccactgtgttatctgttTGtaaaacagtatcctgccctttgtagaataaaggtgtccttgtggagtttataatcaattcactttggttgcattcttagtgtggctaaggct
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35349 | CTG GCA TTC CAC TGT GTT ATC T | Common | A | |||
35350 | AGC CTT AGC CAC ACT AAG AAT G | Mutant Reverse | A | |||
35351 | TCA CAA TGC ATG CTC AAC AG | Wild type Reverse | A | |||
35352 | Fluorophore-1 | AGA ATA AAG GTG TCC TTG TGG AGT T | Quencher-1 | MUT Probe | ||
35353 | Fluorophore-2 | TGA ACT GTC TGG TTT TAG AAC AGG T | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35349 | 0.40 uM |
35350 | 0.40 uM |
35351 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |