For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 030940
Protocol 30683: Probe Assay - Map3k20<em1(IMPC)J> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:72210271+72210368 98bp ACCATCACTGCTTCCGAGA GGCTCTACAGTGGTGCTTCC
Mutant= 107 bp
Wild Type = 98 bp
Sequence
Wt Sequence: accatcactgcttccgagaaacaaataatgcagagcctgaccagcgcgaggcctGCcgggcacgctgtcgagctgggtggaagcaccactgtagagcc
Mutant Sequence: acgcccagcttatatcgtgaagttagaaatgtagtggtttcaacgttagaaacatgacgccatACcgggcacgctgtcgagctgggtggaagcaccactgtagagcc
609 bp deletion beginning at Chromosome 2 positive strand position 72,371,660 bp CTTTTCTTTGGTGCTAAGGT, and ending after CCTGACCAGCGCGAGGCCTG at 72,372,268 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35176 | Fluorophore-1 | CAG AGC CTG ACC AGC GC | Quencher-1 | WT Probe | ||
| 35177 | Fluorophore-2 | CAA CGT TAG AAA CAT GAC GCC | Quencher-2 | MUT Probe | ||
| 35178 | ACC ATC ACT GCT TCC GAG A | Wild type Forward | A | |||
| 35179 | GGC TCT ACA GTG GTG CTT CC | Common | A | |||
| 35180 | ACG CCC AGC TTA TAT CGT GA | Mutant Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35178 | 0.40 uM |
| 35179 | 0.40 uM |
| 35180 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.