Protocol 24702: Standard PCR Assay - Generic Human PSEN1 cDNA Multiplex1
Version 1.2

Notes

This assay will NOT distinguish hemizygous from homozygous transgenic animals.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Tg = 138 bp
IPC = 324bp

Sequence

TCATGACTATCCTCCTGGTGGTTCTGTATAAATACAGGTGCTATAAGGTCATCCA
TGCCTGGCTTATTATATCATCTCTATTGTTGCTGTTCTTTTTTTCATTCATTTACTT
GGGGGAAGTGTTTAAAACCTATAACG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
13763 TCA TGA CTA TCC TCC TGG TGG Transgene Forward A
13764 CGT TAT AGG TTT TAA ACA CTT CCC C Transgene Reverse A
oIMR7338 CTA GGC CAC AGA ATT GAA AGA TCT Internal Positive Control Forward A
oIMR7339 GTA GGT GGA AAT TCT AGC ATC ATC C Internal Positive Control Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
13763 0.50 uM
13764 0.50 uM
oIMR7338 0.50 uM
oIMR7339 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.