For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 84 bp
Wild Type = 94 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
gaataaatcacctcgcccttggctctcgcctctgcagttcactgcctctttccctggccgcttgaccctttctttatctagtggcccctcagcaatgatttctagaacgccataggtctttggcgcctcgatttttgccctgactccctggcccccaagaccctccttcgtccaagcatgagtttggcccacaccaccgtgctCCtcgctgttgtcccaacttctctgcccaaacccttctctagctgtgacgaccagtcgtgttacaatgtttgttaaatgataccagacgcttatggtgggcaccttgggctgggacacgcgacagggtgatgagcaagtctgttagttacagtcggcctcctggtttcatgggagaagcctgggtctaatctgggaagtggaa
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences: TCTCCACGATTTCAAAGGCC, CTCCTTCTCCACGATTTCAA, ATTGGCAACAGCAACGACAG and AGTTGGGACAACAGCGAGAT. This resulted in a 1,185 bp deletion of Chr11:102,885,399 - 102,886,584 (GRCm38/mm10) that removes most of the coding region of exon ENSMUSE00000647300.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 82197 | TTC GTC CAA GCA TGA GTT T | Common | A | |||
| 82199 | CAC AGC TAG AGA AGG GTT TG | Mutant Reverse | A | |||
| 82201 | Fluorophore-1 | CTC CTC GCT GTT GTC CCA AC | Quencher-1 | MUT Probe | ||
| 82752 | AAA ACG CTC TCC TTC TCC A | Wild type Reverse | A | |||
| 82753 | Fluorophore-2 | AGT CTC CAG GCC TTT GAA ATC | Quencher-2 | Wild type Reverse |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 82197 | 0.40 uM |
| 82199 | 0.40 uM |
| 82752 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.