For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 90 bp
Wild Type = 98 bp
>chr17:23560158-23560255 98bp CTGGACTTTCTGGGCTTC GACACAACTTAATCCTGGGA
Sequence
Wt Sequence (deletions in lower case):
TTTTCTGGACTTTCTGGGCTTCCATTTGGTCCCTACCCCTCCCCAACCCTTAGGCTCCtaagggctgtgtcccagaactccttcccaggattaagttgtgtcatccctgacctccaggctggtctctgctaatgggcgcgttatggtttctgcgcaggatgagctctcagaggcggagccgaaggcagcagtccagggactccaagccacagggtctccccagaagacaggggtccagaagcaactccctgcactccaagggcagcgcagccatggtgagtgtgactcttcagtcagcagtgtggccacacaggggcgctattcctcctctagaattgccccagagtgacaggcagcagaagctcagtcacacaagtacccgcgcgactgcatctgaccggggtgggggtggggtggggggagtgggggtgggtgtgggtgggagtgggtggggggtgtgggtgtgggggtgtgtgtgcacctgcaagtgtagatgaagccatccgtctCAGCCCTTGACTTTAGCCTGTATGAAGCTCTGTTCTTTTCCTTCAGCCCA
This mutation is a 451 bp deletion of Chr17:23,559,751-23,560,201 (GRCm38/mm10) that removes exon ENSMUSE00000612785.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79913 | CTG GAC TTT CTG GGC TTC | Common | A | |||
| 79914 | GAC ACA ACT TAA TCC TGG GA | Wild type Reverse | A | |||
| 79915 | AGA ACA GAG CTT CAT ACA GG | Mutant Reverse | A | |||
| 79916 | Fluorophore-1 | AGG GCT GTG TCC CAG AAC T | Quencher-1 | WT Probe | ||
| 79917 | Fluorophore-2 | CTT AGG CTC CCA GCC CTT GAC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 79913 | 0.40 uM |
| 79914 | 0.40 uM |
| 79915 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.