For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 120 bp
Wild Type = 126 bp
Sequence
Wt Sequence (deletions in UPPER case):
gccattcagaagaacctttacaaatgagttagatgacatctgaagatgacagcaactgtcatcagtagaacagcagcactctgaatcttgtggcttcttagactcaatagccaagagatctaagatactctagcagaactacgtggcccaaagctgacctcaggccacagaaccccacgccactacccttaaAGAAAGGTGATGTTATTATACCTGTTGTATAGGTGAAGGTGAAGAAAGGAAGGTACCAGGAACACCTGTGTCTTACAGGCCATGGGTGGCCAATGATGCACTAAATACTGATTATTTGGGGGGTGCTATTCACAGAAGTCACTTATGTGCCTTGTATCTTGCAGCTATGGAAACTCTGCTCTCAAAACAGAAACAGAGATGTTCGAGAAATATTACTCTAGACTGGAACCCAGGGACCACCGAATGACACGGTTGTCAGATATTAAAATAACAGCAGCAGAATTTTCACAGGTACACGATGAAAGGTGAACAGGACTTCATCCTGTTggcctccataaatgcatattgtgtgtgtgtgtgtgtggctaccttagtcatgtcttcttgggtcaaatggccatagcatttcctctcttctattttctgattatttcttcctttctagtttctttcacgtgaggaatcccattcagttagtagcagactctttctggataccttaatttatatgggtgaattccttgcaggttagtagggtggcacacacctgtgatcccagcacttgggaggtcaaggaaggaa
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ACGCCACTACCCTTAAAGAA and ATGCATTTATGGAGGCCAAC. This resulted in a 327 bp deletion of Chr8:95,536,301-95,536,627 (GRCm38/mm10) that removes exon ENSMUSE00000241797
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79747 | ACT CTA GCA GAA CTA CGT GG | Common | A | |||
| 79748 | CCT GGT ACC TTC CTT TCT TC | Wild type Reverse | A | |||
| 79749 | GAC ATG ACT AAG GTA GCC AC | Mutant Reverse | A | |||
| 79750 | Fluorophore-1 | CAC TAC CCT TAA GGC CTC CAT AAA | Quencher-1 | MUT Probe | ||
| 79751 | Fluorophore-2 | CCT GTT GTA TAG GTG AAG GT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 79747 | 0.40 uM |
| 79748 | 0.40 uM |
| 79749 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.