For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 101 bp
Wild Type = 84 bp
Sequence
Wt Sequence:
GGTTCCAACAAGTACGGCGTGTTTATGCGAGTGAGTGAGGTGAAGCCCACCTACCGCAACTCCATCACCGTGCCCTACAAGGTGTGGGCCAAGTTCGGACACACCTTCTGCAAGTACTCCGAGGAGATGAAGAAGATTCAAGAGAAACAGAGGGAGAAGCGGGCCGCTTGTGAGCAGCTCCACCAGCA
Mutant Sequence:
GCCCTGGTGCGGCTACTGTCCTCAGCCCAGCTCCCCCCTCTGGTGAGTGCGCCCGCCCGACAGTTTCTCTTCTTGACTTGCCACCCATCGCTGGATGTTGTCCACTTTATCCACCATATAAAACAGTAAGCAGCTGCTAAAACA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66705 | Fluorophore-1 | CCC GCC CGA CAG TTT CTC T | Quencher-1 | MUT Probe | ||
| 69919 | CTA CTG TCC TCA GCC CAG | Mutant Forward | A | |||
| 76973 | GAG CAC CAC CCA CAG AAC | Wild type Forward | A | |||
| 76974 | TGG ATA AAG TGG ACA ACA TC | Common | A | |||
| 76975 | Fluorophore-2 | CAC CAA CTG ACA GTT TCT CT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 69919 | 0.50 uM |
| 76973 | 0.50 uM |
| 76974 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.