For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 114 bp
Wild Type = 129 bp
Sequence
Wt Sequence (deletions in UPPER case):
catatttcaccttgttttctcctgcttgtgattctgaaggccatcggtgcgtgtgagcatcagagagagtggatttatgaatcattttccattaaggcagtgctctgcactgtcattcctgggggcagggcttggggtggaggcaccctcactttcccacactgtccctcacccactccagccacacctcactaggtggtcctggctaactccttgagtcagtgacctccacgggcctcattctttctcctctgtacTGTGCTAAGGACACTGCCAGCCTCGAAGAGCAGAGAGGACTAAATGCTTGTCACAGGCCAGGCAGCTCACACGGACCTCAGAGTACATAGCTGCAGGTACAGCTCTTAACTGCCCAAGATAGAATCAAATCTTATTTATCTTTCAGCTTGGAGCCAAAAAAGGAAGCTTGGGAGCCCAGAAACTGACAAATACATCCTTCACTGAGATCGAAAAGCAAGCTCAGGCTGTGGATAAGAGGAAGGAGCAGGAAGACCTTGCCAGGGGTGCCCCAAAGGAGGAGTCTATGTAAGCGACATTTGCTTTCTCTAACACACCTTAGCAGGGAGAGCTGTCTATGCCTTGACTTGGTTTGTTTTCCAAATACCTTGAATTTTTGGTGAGTGTGCTATACagggtgtagtttcatgagaatttgtgtcatacaggcatgtgtgttggaaaggacaggactggtggctctggggaacagcagtggtccttgggggagccatgggcaggaagagcagatgggacataatgtcagggaaatgccacttctgacccaggaagacaactgtaacagaaaagacaggctagtgcagtgttcccctccagagccaccccaacagtcaggtactgaggtggggtgcagaaggcagaccagaggctgatgtcctggccattaactctctcttgctattctggggccaaaagctgatgtcttgaggcggttacctcctgagaccactgcgaggcattgagaagcagacacttagttacctgggctcttttctctttgactcatgggagagcgctgaccaggtgagaggcctg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TTTGGTGAGTGTGCTATACA and GTGTCCTTAGCACAGTACAG. This resulted in a 392 bp deletion of Chr15:83,322,468-83,322,859 (GRCm38/mm10) that removes exon ENSMUSE00000247904.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 76622 | GCA GGG AGA GCT GTC TAT G | Wild type Forward | A | |||
| 76623 | CTG TCC TTT CCA ACA CAC AT | Common | A | |||
| 76624 | TCC TGG CTA ACT CCT TGA G | Mutant Forward | A | |||
| 76625 | Fluorophore-1 | CCT TGA CTT GGT TTG TTT TCC | Quencher-1 | WT Probe | ||
| 76626 | Fluorophore-2 | CCA CGG GCC TCA TTC TTT CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 76622 | 0.40 uM |
| 76623 | 0.40 uM |
| 76624 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.