For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 89 bp
Wild Type = 110 bp
Sequence
Wt Sequence (deletions in lower case):
TCATGTGTTGTGTCCCAAGAGAACATTAGCGATAATTACCATAACTATAATAACAGCTCCAAGTCCTGCAGTAAAGCAACTATTAACATTTTTTTAAGTTTATTCAGGTTTTCTAAAAATTATGAAGCACAGAAGTTGTTTGAAtgttcctaagggcataattggggtgactttggtttcaaggggtagtgtgggaatagttgtcatgttcacttgtagattgatcattggcgtcagtcataaggcaaactcacagaatagaatgctggccagacctgtagtagacctatgctaaagaaattgcccactatcaaaatgaagtgtttttgattgggggggctcctaaacagtttgccatctcttggaacaagaacgacaacaacacaaccagttaaagcatacatggcagaaggccaacgaccagtttctggaatctcagcgtttgctgatgagagacatgcagagaatggagattgtgttaacttcggaacagctccgacaagttgaagaactaaagaagaaagaccaggtgattgggcttttttttttttttctttgtttgaaagattgattttattttttattctgtgtatttgtgtctgtgtgttttttggaaggggtgtttagtgcacattgaagctggaggcacagtcagttgtgaatttcctgatgtgggtgctctgcaagagcaagagctaagctatccctccagcccagacagttgtttcttaggcatcatggttagtgatcatgctcctgttcatatcacagtgcgtatgtgGGAGGCTGACTAAGCTGGAGCAAGATGCTTTGTGACACTTTATTATCATTTATTTGTGATTCTGGGGATCATACTGAGGGGTCTTGCTCATGCTGGGCAGATGCTTCCCCACTGTGCAAAATCTCTAACTCTTAGTGATTTTATTTTTAATGTTACTTTGAAAAAACATAGTAGCTACCCAAA
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: AGTTGTTTGAATGTTCCTAA and TATCACAGTGCGTATGTGGG. This resulted in a 637 bp deletion of chr11:70,904,399-70,905,035 (GRCm38/mm10) that removes exon ENSMUSE00001294738.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 76028 | TGA AGC ACA GAA GTT GTT TG | Common | A | |||
| 76029 | GCC AAT GAT CAA TCT ACA AGT | Wild type Reverse | A | |||
| 76030 | CCC CAG AAT CAC AAA TAA ATG A | Mutant Reverse | A | |||
| 76031 | Fluorophore-1 | CTA AGG GCA TAA TTG GGG TG | Quencher-1 | WT Probe | ||
| 76032 | Fluorophore-2 | TGA CTA AGC TGG AGC AAG ATG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 76028 | 0.40 uM |
| 76029 | 0.40 uM |
| 76030 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.