For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 64 bp
Wild Type = 116 bp
chr10:61666860+61666975 116bp TGACGAATGCCTAAATACTCA CCTTCTAAACCAATCAACAGT
Sequence
Sequence (deletion in UPPER case):
gggtttctctgtgtaaccctgactgtaattagaatgtattacccataaggagataataattgagtctacttttcttggggtttttttggtgtgtaattggagtgtgaacctttgacatacagcctcaacctgcctgttttagtatctcatacccttcttacagaaagatgctagcagccaaaccgGTTTGATTACACAGCCCCACTCACTTCTCTTCTTGGATCCGATAGCAGTTAGTCAGGCTTGGTCGCTCTCTTCAGTTCTTAATGTCAAAGCTACTCAAAGATGCAGGATGAATTTTTTTTTTTTAATTTTTAAAGTGTTCTTTTCTCAGCTTTAATATTATCTTGGACTTCTTTACAATTTTCCCTGTATATCTCAATGTAAACTTGATATTTTTGACGAATGCCTAAATACTCATTGTGCGATGTGTCGGGTTTCTTTCCTTAGATATTTCTGATGTCGAACGGCTAAAACCCGGCTATTTAGAAGCTACTGTTGATTGGTTTAGAAGGTATAAGGTTCCTGATGGAAAACCAGAAAATGAGTTTGCATTCAATGCAGAATTTAAAAACAAGGTATTGTGTCTTTTTAAACCTGTGGCTTTAGAGCATTTGTATCGGGACTTAGTATTTTACTATGTTGTTCCCATGTAAAGgttcatgagagaaagggccaggggtatgtttccatggtatgtataagttcttgtgtagtgtatgtaagaccctgggctccgtccctagcactaaccctcccagaattacccatgaaacctgcagtacggggctcctttccaccagttgaacctaacagtttacgtgaagtccc
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTGGGGCTGTGTAATCAAAC and TCTCTCATGAACCTTTACAT. This resulted in a 473 bp deletion of Chr10:61,666,646-61,667,118 (GRCm38/mm10) that removes exon ENSMUSE00000275919. Founder 07M
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73514 | TGA CGA ATG CCT AAA TAC TCA | Wild type Forward | A | |||
| 73515 | CCT TCT AAA CCA ATC AAC AGT | Wild type Reverse | A | |||
| 73516 | Fluorophore-1 | TAT TTC TGA TGT CGA ACG GC | Quencher-1 | WT Probe | ||
| 73517 | TCT CAT ACC CTT CTT ACA GA | Mutant Forward | A | |||
| 73519 | Fluorophore-2 | CTA GCA GCC AAA CCG GTT CA | Quencher-2 | MUT Probe | ||
| 74177 | CCC TGG CCC TTT CTC TCA | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73514 | 0.40 uM |
| 73515 | 0.40 uM |
| 73517 | 0.40 uM |
| 74177 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.