For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman probe protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 80 bp
Wild Type = 77 bp
Sequence
Wt Sequence (deletion in UPPER case):
gtccacaagatctgtagttatttgttcttaagtgggggtagtactttcccacagaggcctcaactcacagaaatttctcacagaaatctcaactaagctaatacttttccactaaggccaaggcttggtaaataagcacttatggctgacaaggcagttaacattcaaacagggtcgctcctaacagattacatcatacttcaccttctctagtactagattataagtagtaacccttattttccttagcctaatcatagtatatcttcggcccaccTAAAATTAATTTGGTGTAAGGAGATGTTGGTATGTCTGCTCCCATGCCGCAAAAGCCCTGGCTGGTTGTCAGTTTATGAGCCTTGCTTTATCAACTCATTCTCCCGAAACTGGCTTTTACAGGACAGACAAGACAGTaATTGGCTGCAGTGGTTTCCATGGAGATTGTCTCACTTTGACAAAGATTATTGAAGCAAGATTAAAGGTAGGTGCTTTTGAACATGTCGCTCTGTTGCAACAATTCACAGCACAGCTGCATTTAGaGAGACAGCAAGTTAGCAGGTGCAGTTAGCATATCCTAGAAATAAAGCAGAGCCAACCCTGGCTGTGGAGGTCATTCAGGTAACAGGAAACTGCAGCACAGGTTAGAGGTCTGCTAAAGTCTCTGTGCCTTGGCAGGGCTGTCTACTGTATAGAGGGCTCTTCTGAAGTGTGTCAGATCTGGCTGTGGCAAAAGACAGCCTGGGCAGCGTATAGCTAGGAGCAGGatttggaactctctgctcaccgttctcctcctccacagccttccactctagtagacagcacaaaaggaggaaaaaataattctggaacgtggtgaatggtggtagcccatcacttggcaggcttcggtggtaggtatgatgtgatagggatgtttttgggggtaggggtgaccacattctctgttgcctactgagttcacttaagggaacataatctcatagtcatggaaagttcacttacatttcctgtggggctgtgga
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTATAGCTAGGAGCAGGATT and ACACCAAATTAATTTTAGGT. This resulted in a 487 bp deletion of Chr17:15,492,815-15,493,301(GRCm38/mm10) that removes exon ENSMUSE00000135936.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 74151 | AGC CTA ATC ATA GTA TAT CTT CGG | Common | A | |||
| 74152 | GCA TGG GAG CAG ACA TAC | Wild type Reverse | A | |||
| 74153 | TAG AGT GGA AGG CTG TGG A | Mutant Reverse | A | |||
| 74154 | Fluorophore-1 | TTT GGT GTA AGG AGA TGT TG | Quencher-1 | WT Probe | ||
| 74155 | Fluorophore-2 | TGG AAC TCT CTG CTC ACC GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 74151 | 0.40 uM |
| 74152 | 0.40 uM |
| 74153 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.