For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 109 bp
Wild Type = 99 bp
>chr15:73820450-73820548 99bp TGCTCTGTCCCATCTTAAAC GCGAGCATATAATGAAAGCC
Sequence
Sequence (deletion in upper case):
tgagatgaagagctagatcactgaatatatagacattaggatgaattgatgggtgggtgggtagataaatgggtgaatgaatattagaatgataataataatatgaatgagagaaggagaatgtgcagatgagaatgtattcctgctctgtcccatcttaaaccccatgaaggaccACGTAAAAAGCAAGCTATCAGACAACTTCCCAGTGTGTCTGGCTCTGGCTTTCATTATATGCTCGCCCCTCTTTACCCATCCAACCCCCTGCCACAACGTGACCTCCCAAAGGCCCATCATCCTCACATCCTCCTTGTCATCTTTAGCCATCTGCTTCAAGATGCTCCGAGACATAGGCACCTCAGACCTTCTCCAAATCAAGTACATCACCAAGAAGATAAAGAAGATGGCTCGGAGCTTCCCCAACCTGGTGATGGAAACCATCCACGACTACTTCAAAGACAACCCAGAGGTGGTGTTGCTTAGGCCCCTGGGgcaggcgtggaagcatagggagcccctggaccctaagtggcactcaaaccctgaatccttcatgagaaagttgcattattctggcaaaatctcaatctacttgcacgccactaggctaagtagggaggaagggaaatgtacccagttacctttgccatgctcagagcacactcgtgaggtagaggttatgactctcactcttgaggactatggcttagggaagaggagcatttgcctaaggtcacagaactagtaaatggtagaaactggtaggtgggtgggaagtgg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATGCTTCCACGCCTGCCCCA and CTGATAGCTTGCTTTTTACG. This resulted in a 316 bp internal deletion of Chr15:73,820,200-73,820,515 (GRCm38/mm10) that removes exon ENSMUSE00000754461 and has a 1 bp insertion. Founder 10
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73311 | TGC TCT GTC CCA TCT TAA AC | Common | A | |||
| 73312 | GCG AGC ATA TAA TGA AAG CC | Wild type Reverse | A | |||
| 73313 | Fluorophore-1 | AGC TAT CAG ACA ACT TCC CA | Quencher-1 | WT Probe | ||
| 73314 | TGC AAC TTT CTC ATG AAG GA | Mutant Reverse | A | |||
| 73315 | Fluorophore-2 | TGG ACC CTA AGT GGC ACT CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73311 | 0.40 uM |
| 73312 | 0.40 uM |
| 73314 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.