For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 97 bp
Wild Type = 114 bp
>chrX:107103373+107103486 114bp CTATCTCGTCATGGAAGCTC GTCAGGTAAAGAGAATCCTAACT
Sequence
Wt Sequence (deletions in lower case; insertion with carrots^^):
TATTCTATATCTCAGTGTAAAAGAGAGCCCTAGATATTCACTAAAGTATTATTTAACCATTGTGCCTTTAAACTTTGTGTGTTTTTTTTTACAGGAGCCATAATTCCACAGTTTTCCTTGccaaacatactgaaatattcaA^a^GatgggcagcaacagtaccagcagtgctgagagcaattgcaatgccacttatttgccatttcagtactctctgtatgcaactacctatatcttcatattcatcccgggtctcctggctaacagtgcagccctgtgggttctgtgccgcttcatcagcaagaagaacaaggccatcattttcatgatcaacctctcagtggcagaccttgctcatatcctgtccttacctcttcggatttactattatatcaatcgtcactggccattccagagggccctttgcctgctgtgtttctatctgaaatatctcaacatgtatgccagcatttttttcttgacatgcattagccttcagaggtgcctctttctcctcaaaccattcagagccagaaactggaagcgtaggtacgatgtgggcatcagtgctgtcatctggattgttgtagggactgcctgtttgccatttcccatcctgagaaatgctggcttagccaatagcacagattcttgctttgctgatcttgggtacaaacagatggatgcagtggttctggtcaccatggttgtaattgctgaacttgctggatttgtgattccagtgatcaccattgcatgttgtacctggaaaacaactgtatccttgaaacacccaccaattgcttttcaagggattagtgagaggaaaaaagcattgcggatggttttcatgtgtgctgcagtcttcgttatctgcttcactccttatcacattaacttcattttttacaccatggtaaaggaaagcatcattaccagttgtcccactgtaaaaagtaccctgtatttccatcctttttccctatgccttgcaagtctctgttgtcttttggacccaattctgtactatttcatggcttcagagtttcgtgaccaactatctcgtcatggaagctctgttactcgttctcgtctcatgagcagggagagTGGATCATCAATGGTTAACTAAAATGAGAAAATTCTTCAGTTAGGATTCTCTTTACCTGACATTCTGTGGCATTGCCCAAAGGCAGGAATTTCCAGGCAAATAATTTCTTTAACTGAACCTTGGAA
This mutation is a 988 bp internal deletion of region ChrX:107,102,438-107,103,425(GRCm38/mm10) and removes most of exon ENSMUSE00000383594 and has a 1 bp insertion at ChrX:107,102,459.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 71609 | CTA TCT CGT CAT GGA AGC TC | Wild type Forward | A | |||
| 71610 | GTC AGG TAA AGA GAA TCC TAA CT | Common | A | |||
| 71611 | TAC AGG AGC CAT AAT TCC AC | Mutant Forward | A | |||
| 71612 | Fluorophore-1 | TGT TAC TCG TTC TCG TCT CA | Quencher-1 | WT Probe | ||
| 71613 | Fluorophore-2 | TTC CTT GCA AGG TGG ATC ATC AAT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 71609 | 0.40 uM |
| 71610 | 0.40 uM |
| 71611 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.