For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 76bp
Wild Type = 89 bp
>chr17:74747859+74747947 89bp ATTGTATGGCTTGTGAAGGT GGAGAAGGAGCTACAAACTC
Sequence
Wt Sequence (deletion in lower case):
TTCAGGAGGCTGAGGCTGGTGGACCTTTGTGAGTTTAAGACTAGCTTGGTTTGCCTAGTGAGTTCAGGCCAGCCAGGGCCACATAGTGAGACCCTGTTTTAAATATCAACAAGAGACAGAACACCAAGCCAAACTAAACAAAAACTCCAAAGAAAATCAAAATAAAAATAATGTACCCCAACCTCCCTCCAAAAACCCCAGCaagcatcaatatcatttccattagcagtctattgaattaatgaatgaataaatgaatgaaagaatgaaagaatgaaatgtaactcttgttctaaatattttcttttgtgtcccactagaatcttgagctcaatgatgatactgttctgaatgaaataaagttagcagatagtgaacggtttcagatgccagacctgtgtgcggaggagcttgccgtggtccttggagtctggtacgttaatgtctgacttggctgtgttgaacgctttgactgttgtcccctgagtttgggaagatcttcatcaaaacctccttgtacagtaggtattgtatggcttgtgaaggtggagacttcttgggcaacgatttaaaggaTCAGAGGTTCAGAATCTATTGAGTTTGTAGCTCCTTCTCCTAGTCTTTGGTTATCTTCAACTAGGTGTAGATTTTTAATCAAGTCCTAATAGACGAGAGTGATTGTGTGTGGGGGATGCATGGAGAGGCAGAGGTGGTCTGTGGATGTTCACACCAGTGCTCCCCACCTTATCTTTCGTTAGACAGGATTTCTCACTGAACCTGATGCTCACCTCTGTGTTGCCTATAAAAGGGATCCCTTCTTTGTCCTCATAAGACTAGGTTACAGAT
This mutation is a 374 bp deletion of region Chr17:74,747,534-74,747,907 (GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 71604 | ATT GTA TGG CTT GTG AAG GT | Wild type Forward | A | |||
| 71605 | GGA GAA GGA GCT ACA AAC TC | Common | A | |||
| 71606 | AAT AAT GTA CCC CAA CCT CC | Mutant Forward | A | |||
| 71607 | Fluorophore-1 | TTG GGC AAC GAT TTA AAG GA | Quencher-1 | WT Probe | ||
| 71608 | Fluorophore-2 | AAC CCC AGC TCA GAG GTT CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 71604 | 0.40 uM |
| 71605 | 0.40 uM |
| 71606 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.