For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 93 bp
Wild Type = 103bp
>chr4:115787913+115788015 103bp AACCCAGCAATATGACTTGA TTTTCTTTTGCAGGCTACTC
Sequence
Wt Sequence (deletion in lower case):
TTCTTCCAGAGCATCCATTTGGAGTACAGGATCTGATGGTGGGTATAGAAGGAGACGTCAAAAATTAGATATATTCAGGTAAAACCTTAACACTGAGTAGGCACGCTGTAGGATTCCTGCCTGTGGAGGTAACCCAGCAATATGACTTGACAGTATTCTTTCTCtcttgagtggcttaagaacctaagaaagcgagccctgcatcacctgagcgagtagcctgcaaaagaaaaataaagcaaaaaaacaaaacaaaaacagtgttgcactgctgatccctagaggcttacctatagctgagtaactggctttgctttccactgccttgactttcaggcttataccctgttcttaactgaatgcaaaccctttagcctcatggtgtctgtgtcccttctctgaggaggtgcgatggagtgcttccttatttcaaagcccgcaaaggcctgcgtgcttcacctttatttaccttttgtcaggtctgacccagcggcctttgagtcccgcctggagaagcgcagtgagttccgaaagcagccagtggggcactccaaacaaagtgattttatcaagtgtatggagcagaaggtaagatgtactgggcctcggaggttggttttgtcttgttgtataagcttactagcccttaccctttaagTGGTCGCCAGTGACCGGAACATCTCATCTTTTCTCATTCTCCGTCAGTAAATGTGTACCCTGCTCTTGCTAGACAAGATCCTGTAGTCATGTTGGAATGTAGAAGACTGAGAGGAGAGTCCCCAC
This mutation is a 494 bp deletion of Chr4:115,787,947-115,788,440 (GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 70666 | AAC CCA GCA ATA TGA CTT GA | Common | A | |||
| 70667 | TTT TCT TTT GCA GGC TAC TC | Wild type Reverse | A | |||
| 70668 | GGT ACA CAT TTA CTG ACG GA | Mutant Reverse | A | |||
| 70669 | Fluorophore-1 | AAG AAC CTA AGA AAG CGA GC | Quencher-1 | WT Probe | ||
| 70670 | Fluorophore-2 | CTT TCT CTG GTC GCC AGT GAC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 70666 | 0.40 uM |
| 70667 | 0.40 uM |
| 70668 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.